Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 548317
End position: 548340
Length: 24

DNA sequence
>NC_012988, from 548317 to 548340 (24 bp); Methylobacterium extorquens DM4 GTCGCGGTCGAGATCGCGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 547832-548449	Sequence	METDI0581 thiE thiamine-phosphate pyrophosphorylase (Protein is coded in complementary strand; from 548449 to 547832)