Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5390483
End position: 5390506
Length: 24

DNA sequence
>NC_012988, from 5390483 to 5390506 (24 bp); Methylobacterium extorquens DM4 CGAGGGCGAGGAGGAGGGCGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5390071-5390517	Sequence	METDI5442 - hypothetical protein (Protein is coded in complementary strand; from 5390517 to 5390071)