Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 5344370
End position: 5344393
Length: 24

DNA sequence
>NC_012988, from 5344370 to 5344393 (24 bp); Methylobacterium extorquens DM4 TGGCGGCGGCGGCGGCGGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5343020-5344429	Sequence	METDI5398 leuC 3-isopropylmalate isomerase subunit with LeuD