Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4909706
End position: 4909729
Length: 24

DNA sequence
>NC_012988, from 4909706 to 4909729 (24 bp); Methylobacterium extorquens DM4 GCCGCCGCCGTCGCCGTCGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4909605-4909982	Sequence	METDI5010 rplL 50S ribosomal subunit protein L7/L12