Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4858539
End position: 4858562
Length: 24

DNA sequence
>NC_012988, from 4858539 to 4858562 (24 bp); Methylobacterium extorquens DM4 GCCCTCGCGCTCGACCTCGGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4858450-4859067	Sequence	METDI4960 - hypothetical protein (Protein is coded in complementary strand; from 4859067 to 4858450)