Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4765762
End position: 4765785
Length: 24

DNA sequence
>NC_012988, from 4765762 to 4765785 (24 bp); Methylobacterium extorquens DM4 CGGGGCCGGAGCCGGGGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4765745-4766683	Sequence	METDI4876 - CoxB-like protein (Protein is coded in complementary strand; from 4766683 to 4765745)