Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4704325
End position: 4704348
Length: 24

DNA sequence
>NC_012988, from 4704325 to 4704348 (24 bp); Methylobacterium extorquens DM4 ACGACGAGGACGACGAGGACGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4702264-4705395	Sequence	METDI4812 - hydrophobe/amphiphile efflux-1 transporter (Protein is coded in complementary strand; from 4705395 to 4702264)