Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4208265
End position: 4208288
Length: 24

DNA sequence
>NC_012988, from 4208265 to 4208288 (24 bp); Methylobacterium extorquens DM4 GCGCCAGCGCCTGCGACAGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4207952-4209118	Sequence	METDI4265 - capsule polysaccharide export outer membrane protein (Protein is coded in complementary strand; from 4209118 to 4207952)