Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4034013
End position: 4034036
Length: 24

DNA sequence
>NC_012988, from 4034013 to 4034036 (24 bp); Methylobacterium extorquens DM4 CGCCTTCGTCTTCGCCGTCGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4034008-4036740	Sequence	METDI4100 TopA DNA topoisomerase I (Protein is coded in complementary strand; from 4036740 to 4034008)