Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4021362
End position: 4021385
Length: 24

DNA sequence
>NC_012988, from 4021362 to 4021385 (24 bp); Methylobacterium extorquens DM4 CGGCGCGTAGGCGCGTCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4020469-4022052	Sequence	METDI4088 - peptidoglycan lipid II flippase protein, MurJ (Protein is coded in complementary strand; from 4022052 to 4020469)