Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 4020753
End position: 4020776
Length: 24

DNA sequence
>NC_012988, from 4020753 to 4020776 (24 bp); Methylobacterium extorquens DM4 GGCGATGGCGGTGGCGAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4020469-4022052	Sequence	METDI4088 - peptidoglycan lipid II flippase protein, MurJ (Protein is coded in complementary strand; from 4022052 to 4020469)