Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3888993
End position: 3889016
Length: 24

DNA sequence
>NC_012988, from 3888993 to 3889016 (24 bp); Methylobacterium extorquens DM4 CCTCGGCCTCGCGCTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3888725-3889213	Sequence	METDI3960 - F0F1 ATP synthase subunit b (Protein is coded in complementary strand; from 3889213 to 3888725)