Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3761604
End position: 3761627
Length: 24

DNA sequence
>NC_012988, from 3761604 to 3761627 (24 bp); Methylobacterium extorquens DM4 CGCCGACGGCGATGCCGACGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3761084-3762325	Sequence	METDI3831 - membrane bound lytic murein transglycosylase B, mltB