Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3407135
End position: 3407158
Length: 24

DNA sequence
>NC_012988, from 3407135 to 3407158 (24 bp); Methylobacterium extorquens DM4 CGCCACCGCCTCCGCGACCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3406398-3407630	Sequence	METDI3478 - MiaB-like tRNA modifying enzyme, 2-methylthioadenine synthetase (Protein is coded in complementary strand; from 3407630 to 3406398)