Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 3196179
End position: 3196202
Length: 24

DNA sequence
>NC_012988, from 3196179 to 3196202 (24 bp); Methylobacterium extorquens DM4 GCGCCAGCGCCTGCGACAGCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3195866-3197038	Sequence	METDI3265 - capsule polysaccharide export outer membrane protein (Protein is coded in complementary strand; from 3197038 to 3195866)