Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2993339
End position: 2993362
Length: 24

DNA sequence
>NC_012988, from 2993339 to 2993362 (24 bp); Methylobacterium extorquens DM4 TCCTCGTCCGCGCCCTCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2992859-2993524	Sequence	METDI3077 - hypothetical protein (Protein is coded in complementary strand; from 2993524 to 2992859)