Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2934074
End position: 2934097
Length: 24

DNA sequence
>NC_012988, from 2934074 to 2934097 (24 bp); Methylobacterium extorquens DM4 CGACGGCAACGGCGACCGCTACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2932957-2934795	Sequence	METDI3014 cysI sulfite reductase subunit beta, NADPH-dependent hemoprotein