Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2842727
End position: 2842750
Length: 24

DNA sequence
>NC_012988, from 2842727 to 2842750 (24 bp); Methylobacterium extorquens DM4 CGGTGGCGGTGCCGGAGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2842430-2843209	Sequence	METDI2910 - fumarylacetoacetate hydrolase family protein