Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2305105
End position: 2305128
Length: 24

DNA sequence
>NC_012988, from 2305105 to 2305128 (24 bp); Methylobacterium extorquens DM4 CGCCGCCGCTGCCGCCGCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2303709-2305355	Sequence	METDI2385 - peptidase S15 (Protein is coded in complementary strand; from 2305355 to 2303709)