Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 2180788
End position: 2180811
Length: 24

DNA sequence
>NC_012988, from 2180788 to 2180811 (24 bp); Methylobacterium extorquens DM4 TGCGGAAGCGGATGCGGTTGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2180634-2182970	Sequence	METDI2293 - hypothetical protein (Protein is coded in complementary strand; from 2182970 to 2180634)