Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 215017
End position: 215040
Length: 24

DNA sequence
>NC_012988, from 215017 to 215040 (24 bp); Methylobacterium extorquens DM4 CCGAAGGCGAAGCCGAGGCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 214462-215301	Sequence	METDI0209 ssuC alkanesulfonate ABC transporter (Protein is coded in complementary strand; from 215301 to 214462)