Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 204924
End position: 204947
Length: 24

DNA sequence
>NC_012988, from 204924 to 204947 (24 bp); Methylobacterium extorquens DM4 GAAGCCGAAGGCGAAGGCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 204331-205071	Sequence	METDI0200 aqpZ water channel protein (Protein is coded in complementary strand; from 205071 to 204331)