Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 196966
End position: 196989
Length: 24

DNA sequence
>NC_012988, from 196966 to 196989 (24 bp); Methylobacterium extorquens DM4 CTCGAGCTCGCGCTGGAGCACGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 196706-200233	Sequence	METDI0195 - hypothetical protein (Protein is coded in complementary strand; from 200233 to 196706)