Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1760754
End position: 1760777
Length: 24

DNA sequence
>NC_012988, from 1760754 to 1760777 (24 bp); Methylobacterium extorquens DM4 GGGCACGGGCAGCGGCACGCGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1760407-1761309	Sequence	METDI1879 - oxidoreductase, FAD-binding subunit (Protein is coded in complementary strand; from 1761309 to 1760407)