Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1750361
End position: 1750384
Length: 24

DNA sequence
>NC_012988, from 1750361 to 1750384 (24 bp); Methylobacterium extorquens DM4 GCCGGTGCGGGTGCCGGAGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1749355-1750389	Sequence	METDI1869 dppD dipeptide transporter; ATP-binding component of ABC superfamily