Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1725451
End position: 1725474
Length: 24

DNA sequence
>NC_012988, from 1725451 to 1725474 (24 bp); Methylobacterium extorquens DM4 CGCCGACGGCGAAGCCGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1724904-1725689	Sequence	METDI1847 ssuC alkanesulfonate ABC transporter (Protein is coded in complementary strand; from 1725689 to 1724904)