Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1693363
End position: 1693386
Length: 24

DNA sequence
>NC_012988, from 1693363 to 1693386 (24 bp); Methylobacterium extorquens DM4 CCTCGACCACGAACTCGACCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1693089-1694939	Sequence	METDI1824 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1694939 to 1693089)