Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1615652
End position: 1615675
Length: 24

DNA sequence
>NC_012988, from 1615652 to 1615675 (24 bp); Methylobacterium extorquens DM4 AGGACGAGGCCGAGGCCGAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1614848-1615846	Sequence	METDI1744 - ABC transporter permease (Protein is coded in complementary strand; from 1615846 to 1614848)