Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1537356
End position: 1537379
Length: 24

DNA sequence
>NC_012988, from 1537356 to 1537379 (24 bp); Methylobacterium extorquens DM4 GGAGCCGGTGCCGGTGCCGGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1535996-1537846	Sequence	METDI1671 - glutamyl-tRNA(Gln) amidotransferase subunit A