Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1269582
End position: 1269605
Length: 24

DNA sequence
>NC_012988, from 1269582 to 1269605 (24 bp); Methylobacterium extorquens DM4 TTGCGCGGTGGCGCGGTGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1269567-1269953	Sequence	METDI1398 - hypothetical protein (Protein is coded in complementary strand; from 1269953 to 1269567)