Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1168364
End position: 1168387
Length: 24

DNA sequence
>NC_012988, from 1168364 to 1168387 (24 bp); Methylobacterium extorquens DM4 CAGGAGCGGGAGCAGCAGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1168008-1168406	Sequence	METDI1280 - hypothetical protein (Protein is coded in complementary strand; from 1168406 to 1168008)