Sequence retrieval

Genome: Methylobacterium extorquens DM4
Start position: 1137599
End position: 1137622
Length: 24

DNA sequence
>NC_012988, from 1137599 to 1137622 (24 bp); Methylobacterium extorquens DM4 GAGCGCGAGCCCGACCGCGAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1137027-1137746	Sequence	METDI1244 - cytochrome C biogenesis protein (Protein is coded in complementary strand; from 1137746 to 1137027)