Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 823563
End position: 823598
Length: 36

DNA sequence
>NC_012968, from 823563 to 823598 (36 bp); Methylotenera mobilis JLW8 GATCATGATGATGATCACCATCATGATCACGAGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 822892-823602	Sequence	Mmol_0772 - cation diffusion facilitator family transporter