Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 690391
End position: 690414
Length: 24

DNA sequence
>NC_012968, from 690391 to 690414 (24 bp); Methylotenera mobilis JLW8 TATAGGCATATAGGTATATACGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 689819-690604	Sequence	Mmol_0651 - 3-deoxy-D-manno-octulosonate cytidylyltransferase