Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 587807
End position: 587830
Length: 24

DNA sequence
>NC_012968, from 587807 to 587830 (24 bp); Methylotenera mobilis JLW8 AAACCATTAAACAATTAAACGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 587822-588286	Sequence	Mmol_0555 - transmembrane protein (Protein is coded in complementary strand; from 588286 to 587822)