Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 2286296
End position: 2286334
Length: 39

DNA sequence
>NC_012968, from 2286296 to 2286334 (39 bp); Methylotenera mobilis JLW8 TAACTTATTGCAATGATTTATTGCAATAAATCATTGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2286327-2286626	Sequence	Mmol_2113 - hypothetical protein (Protein is coded in complementary strand; from 2286626 to 2286327)