Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 202799
End position: 202843
Length: 45

DNA sequence
>NC_012968, from 202799 to 202843 (45 bp); Methylotenera mobilis JLW8 GCCAAGCTTGGTGTAGCTAAGTTTGGTGTAGCTAAGTTTGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 202616-204988	Sequence	Mmol_0190 - hypothetical protein (Protein is coded in complementary strand; from 204988 to 202616)