Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 1953957
End position: 1953986
Length: 30

DNA sequence
>NC_012968, from 1953957 to 1953986 (30 bp); Methylotenera mobilis JLW8 TCAGTTTAAATTCGTTTAAATCTGTATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1953866-1955032	Sequence	Mmol_1785 - nucleotide sugar dehydrogenase (Protein is coded in complementary strand; from 1955032 to 1953866)