Sequence retrieval

Genome: Methylotenera mobilis JLW8
Start position: 1706653
End position: 1706685
Length: 33

DNA sequence
>NC_012968, from 1706653 to 1706685 (33 bp); Methylotenera mobilis JLW8 AATTAGCCTTAAATGAGCTTTAAATTAACCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1706168-1706653	Sequence	Mmol_1558 nrdR transcriptional regulator NrdR (Protein is coded in complementary strand; from 1706653 to 1706168)