Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 4465596
End position: 4465631
Length: 36

DNA sequence
>NC_012947, from 4465596 to 4465631 (36 bp); Escherichia coli BL21-Gold(DE3)pLysS AG CTAAACCTGCACCTGCACCTGCACCTGCACCTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4464474-4465679	Sequence	ECBD_4239 - uroporphyrinogen III C-methyltransferase