Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 4062721
End position: 4062756
Length: 36

DNA sequence
>NC_012947, from 4062721 to 4062756 (36 bp); Escherichia coli BL21-Gold(DE3)pLysS AG CATGCCGCCCATGCCACCCATGCCGCCCATACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4062716-4064362	Sequence	ECBD_3888 groEL chaperonin GroEL (Protein is coded in complementary strand; from 4064362 to 4062716)