Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 3804812
End position: 3804838
Length: 27

DNA sequence
>NC_012947, from 3804812 to 3804838 (27 bp); Escherichia coli BL21-Gold(DE3)pLysS AG GCCGCTTTCACCGCTTTCGCCGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3804749-3806071	Sequence	ECBD_3638 deoA thymidine phosphorylase (Protein is coded in complementary strand; from 3806071 to 3804749)