Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 4329629
End position: 4329652
Length: 24

DNA sequence
>NC_012947, from 4329629 to 4329652 (24 bp); Escherichia coli BL21-Gold(DE3)pLysS AG TGGTGTTGATGTTGGTTTTGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4329575-4330948	Sequence	ECBD_4112 cpxA two-component sensor protein