Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 3786603
End position: 3786626
Length: 24

DNA sequence
>NC_012947, from 3786603 to 3786626 (24 bp); Escherichia coli BL21-Gold(DE3)pLysS AG TTCAGCTTCAGGTTCTGCTTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3785844-3787196	Sequence	ECBD_3620 - hypothetical protein (Protein is coded in complementary strand; from 3787196 to 3785844)