Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 3707280
End position: 3707303
Length: 24

DNA sequence
>NC_012947, from 3707280 to 3707303 (24 bp); Escherichia coli BL21-Gold(DE3)pLysS AG GTGCTGGCGCTGCTGCTGTTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3706396-3708006	Sequence	ECBD_3550 thiP thiamine transporter membrane protein