Sequence retrieval

Genome: Escherichia coli BL21-Gold(DE3)pLysS AG
Start position: 2843446
End position: 2843469
Length: 24

DNA sequence
>NC_012947, from 2843446 to 2843469 (24 bp); Escherichia coli BL21-Gold(DE3)pLysS AG TCATCTTCATATTCATCTTCATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2840077-2844105	Sequence	ECBD_2705 - DNA translocase FtsK (Protein is coded in complementary strand; from 2844105 to 2840077)