Sequence retrieval

Genome: Streptococcus suis BM407
Start position: 1826811
End position: 1826834
Length: 24

DNA sequence
>NC_012926, from 1826811 to 1826834 (24 bp); Streptococcus suis BM407 TCTTCCTCTTGCTCTACCTCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1826496-1827218	Sequence	SSUBM407_1745 mecA adaptor protein (Protein is coded in complementary strand; from 1827218 to 1826496)