Sequence retrieval

Genome: Streptococcus suis BM407
Start position: 1704688
End position: 1704711
Length: 24

DNA sequence
>NC_012926, from 1704688 to 1704711 (24 bp); Streptococcus suis BM407 AGTTGAAGATGAAGTTGAAGTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1704317-1704796	Sequence	SSUBM407_1634 - lipoprotein (Protein is coded in complementary strand; from 1704796 to 1704317)