Sequence retrieval

Genome: Streptococcus suis BM407
Start position: 1331744
End position: 1331767
Length: 24

DNA sequence
>NC_012926, from 1331744 to 1331767 (24 bp); Streptococcus suis BM407 TGCTTCTGCTTTCGCTTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1331229-1332176	Sequence	SSUBM407_1239 arcC carbamate kinase (Protein is coded in complementary strand; from 1332176 to 1331229)