Sequence retrieval

Genome: Streptococcus suis BM407
Start position: 1300995
End position: 1301018
Length: 24

DNA sequence
>NC_012926, from 1300995 to 1301018 (24 bp); Streptococcus suis BM407 CAAAGACAAAGGAAAAGACAAAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1299929-1302166	Sequence	SSUBM407_1213 comEC competence protein (Protein is coded in complementary strand; from 1302166 to 1299929)